Research Article Volume 8 Issue 1
1Institute of Endemic Diseases, University of Khartoum, Sudan
2Department of Pathology, Faculty of Medicine, University of Khartoum, Khartoum, Sudan Health Centre Belgrade, Serbia
Correspondence: Professor Eltahir Awad Gasim Khalil, Department off Clinical Pathology & Immunology, Institute of Endemic Diseases, University of Khartoum, Sudan; Director, Elzahrawi Medical Laboratories, Khartoum, Sudan, PO Box 45235, Post Code 11111
Received: February 04, 2020 | Published: February 14, 2020
Citation: : Abbas SMM, Saeed WSE, Musa OM, et al. Immune-pathological phases of chronic Hepatitis B infections among Sudanese individuals towards personalization of management. J Hum Virol Retrovirology. 2020;8(1):1-5. DOI: 10.15406/jhvrv.2020.08.00212
Background: Hepatitis B virus (HBV) infection is an immune liver disease affecting millions worldwide. Despite availability of an efficacious vaccine, elimination of HBV infections is aloft. This study aimed to identify the immune-pathological phases of chronic HBV infection (CHBV) among Sudanese individuals to refine management strategies.
Materials and methods: In a prospective cross-sectional study and following informed consent, 1593 individuals with HBs Ag reactivity were enrolled. Serum total protein/albumin, ALT, AST, total bilirubin, HBs Ag/Ab, HBe Ag/Ab, HBc IgM/HBc total antibodies and HBV viral loads were measured.
Results: Mean aminotransferase levels for HBs Ag-reactive individuals were significantly higher compared to apparently normal individuals, while the mean total protein and serum albumin were within normal ranges. The majority of HBs Ag-reactive individuals were reactive to total anti-HBc and HBe Ab, while concurrent HBe Ag/Ab reactivity was seen in a minority. Inactive carriers constituted the majority of HBs Ag reactive individuals, while the immune tolerance CHBV phase could not be identified. The reactivation phase had the highest viral load.
Conclusion: inactive carrier state is the predominant immune-pathological phase among Chronic HBV Sudanese individuals. Regular follow ups and no oral anti-viral drug treatment as the management of choice to reduce cost, drug-associated toxicities and emergence of resistant strains.
Keywords: CHBV infections, immuno-pathological phases, immune tolerance
HBV, Hepatitis B virus; double-stranded relaxed circular DNA (rcDNA; Chronic hepatitis B virus (CHBV);
Hepatitis B virus (HBV) infection is a major global public health problem, with overlapping modes of transmission. HBV is one of the smallest enveloped animal viruses with a virion diameter of 42 nm; the particles are not infectious and are composed of lipids and proteins that form part of the surface of the virion. The nucleo-capsid structure of HBV contains a genome (3.2 kb in length) of partially double-stranded relaxed circular DNA (rcDNA) molecule and a polymerase enzyme. The outer capsule contains HBs Ag, while the inner core contains HBc and HBe Ags. The virus is not directly hepatotoxic, but the host's immune responses are thought to be the cause of the liver injury. Cellular rather than humoral immune responses are primarily involved in the disease pathogenesis.1–5 WHO has estimated that globally around 240 million people are chronically infected with HBV with 500,000-700,000 deaths annually. Sudan is a country with high HBV sero-prevalence of greater than 8% and HBs Ag reactivity of 16%–20% in the general population.6–9 Chronic hepatitis B virus (CHBV) infection is a highly heterogeneous disease regarding the levels of virus replication, liver disease activity and humoral responses. Symptomatic and asymptomatic forms of acute and chronic infections may be discovered incidentally through laboratory assays of viral markers. Viral markers may occur singly or in various combinations depending on the natural history of infection. The most common outcome after infection is the expression of diverse serological markers of varying clinical and epidemiological significances namely: HBs Ag, HBs Ab, HBc IgM, HBc Ab, HBe Ag, HBe Ab. Detection of these antigenic and serological markers helps to determine immune pathological phases of CHBV infection and help plan better management strategies. Immune tolerance phase of CHBV is always depicted as the early that is characterized by high HBV DNA load, HBe Ag reactivity and normal alanine transferase (ALT) level. The presence of immune tolerance phase has recently been challenged. In addition, some studies have documented a low but persistent immune destruction of infected hepatocytes by low-level cytotoxic T lymphocyte infiltration.1,10–12 During the inactive carrier phase of CHBV no further damage to the liver occurs, with a chance of conversion to immune clearance, reactivation or immune control phases. Most inactive carriers usually have low DNA load, HBe Ag negativity and normal ALT levels. The third CHBV phase is an immune clearance (activation) phase where host immune system becomes mature and begins to recognize HBV-related epitopes on hepatocytes with immune-mediated viral clearance and hepatocytes damage. This phase usually lasts from several months to many years with HBe Ag positivity, high HBV DNA loads, elevated serum aminotransferase levels and active inflammation of the liver. Reactivation phase usually ensues on 20%-30% per cent of inactive carriers during follow up. This phase is usually asymptomatic but can occasionally mimic acute viral hepatitis where appropriate diagnosis and management becomes a necessity.13–18 This study aimed to delineate the immune-pathological patterns of CHBV among Sudanese individuals to inform guidelines of management to prevent drug toxicities and reduce cost.
This was a prospective, cross-sectional, analytical and facility-based study.
Ethical considerations
The proposal was reviewed and approved by the Scientific and Ethics Committees of the Institute of Endemic Diseases, University of Khartoum. Apparently healthy volunteers and HBs Ag reactive individuals were individually consented and asked to sign a consent form.
Study sites
The study was conducted at the Central Blood Bank, Khartoum, Sudan and Alzahrawi Medical Laboratory [a central referral laboratory, Khartoum] and the Department of Clinical Pathology and Immunology, Institute of Endemic Diseases, University of Khartoum, Sudan.
Study population
Individuals with HBs Ag reactivity and apparently healthy volunteers were recruited. Individuals with concurrent HIV or HCV serological reactivity and those who refuse/fail to give an informed consent were excluded.
Blood samples, biochemical and viral serological markers
Ten mls of bloods were collected for biochemical, immunological and viral loads analyses. Alanine aminotransferase (ALT), Aspartate aminotransferase (AST), total protein/albumin, total bilirubin were estimated using an automated chemistry analyzer (Biosystem BTS310, Biosystem, Barcelona, Spain). HBs Ag, anti-HBs Ab, HBe Ag, anti-HBe, total anti-HBc and Ig M anti-HBc were detected using commercially ELISA kits (One-step incubation, competition principle) [Atlas Link Technology Co. Ltd. Beijing, China].
Molecular detection and quantification [viral load] of HBV by qPCR
HBV DNA was extracted from 3 mls of EDTA blood using a modified Guanidine method. [Pramanick et al. 1976]. Briefly: 10 mls of red cell lysis buffer (1mM NH4HCO3+115mM NH4Cl) were added to the whole blood, mixed well and centrifuged for 5 minutes at 4000 rpm and repeated until a clear pellet of white blood cells appeared at the bottom of the tube. Two mls of white blood cells (WBCs) lysis buffer (10mMTris-HCl+0.1mM EDTA+100mMNaCl+20%SDS), 10µl of proteinase K (10mg/ml), 300 µl of ammonium acetate (MW=57.81g/100ml ddH2O) and 1 ml of guanidine (4 M/ 250 ml ddH2O) were added to the pellets. The mixture was incubated overnight in a water-bath at 37 °C. Two mls of chloroform were added and the upper layer was aspirated into a new tube. Ten mls of ice-cold ethanol was added to the upper layer, mixed well and centrifuged for 5 minutes at 4000 rpm. The tubes were vertically dried and the pellet was washed by 4 mls of cold 70% ethanol. The resulting pellets were allowed to dry and were re-suspended in RNase/DNA-ase-free water. The DNA concentration was measured using Nanophotometer® P300 (IMPLEN GmbH, Munich, Germany) and stored at –20°C until analyzed.
Viral load determination
Molecular detection and quantification of HBV were done using commercial kits [Genesig, Primerdesign, UK] with the following primers and probes (FW: 5´AGCGTCTAGCCATGGCGTT3´ RV: 5´GCAAGCACCCTATCAGGCAGT3´ Probe: FAM 5´TCTGCGGAACCGGTGAGT3´ MGB NFQ. FAM as a reporter dye attached to the 5´ end of the primer, a non-fluorescent quencher (NFQ) and minor groove binder (MGB) were attached to the 3´ end of the primer. To determine samples viral loads, a standard curve was constructed from serial dilutions of the positive control [cloned plasmids containing inserts in the conserved region of HBV virus] in an initial concentration of 4.9 × 109 IU/mL and total of eight points in each curve. The amplified product was detected with the use of fluorescent dyes that are linked to oligonucleotide probes, which bind specifically to the amplified product during thermo-cycling. Negative controls were included in all reactions to test kit stability, while internal controls were used to rule out possible false results, monitor all stages of the analysis and reveal the effect of PCR inhibitors. The reactions were performed in Spectrum48 qPCR machine (ESCO Micro Pte Ltd, Singapore).
Statistical analysis
Statistical analysis was performed using the shareware Epi Info version 7. Standard
descriptive statistical analysis and correlations between variables [using t-test] was carried out for biochemical parameters and HBV viral loads. P-value ˂0.05 was considered significant.
A total of 1593 individuals with HBs Ag reactivity and 300 apparently healthy individuals with HBs Ag non-reactivity (comparators) were enrolled. The mean age was 35.4±11.6 years and 32.00±9.9 years for the hepatitis B surface antigen positive and comparator groups respectively. The male: female ratio was 3:1 and 1:1 in the hepatitis B surface antigen positive and the comparator groups respectively. Male patients were more frequent compared to females in the HBs Ag positive group (p=0.0001). The commonest age group among infected individuals was the 28-37 years. Mean aminotransferase levels for HBs Ag reactive individuals were significantly higher compared to comparators (ALT: 20.8±37 IU/L and 10.5±6.2 IU/L; p=0.004) (AST: 37.0±124.1 IU/L and 13.5±7.2 IU/L; p=0.007). Mean total proteins and serum albumin, were comparable in both groups (Table 1). Hbe Ag reactive individuals (4.9%, 78/1593) had significantly higher aminotransferases, total and direct bilirubins compared to Hbe Ag non-reactive individuals (p=0.001) (Table 2). The majority (77.7%; 1238/1593) of the HBs Ag reactive individuals were reactive to total anti-HBc antibodies, while a small percentage [2%; 32/1593] was HBs Ag+/HBe Ag+ and Ig M anti-HBc reactive. The majority (80.0%, 1274/1593) of HBs Ag+ had HBe Ab, HBe Ag and concurrent Hbe Ag/HBe Ab reactivity was seen in a minority (4.9%, 78/1593; 6.0%, (98/1593). Fourteen per cent (221/1593) of HBs Ag reactive individuals showed no Hbe Ag/HBe Ab reactivity, while anti-HBs was seen in a minority (2.9%, 46/1593). No individuals fitted the criteria for immune tolerance, while immune clearance, reactivation and inactive carriers phases were seen in 2.2% (35/1593), 1.3% (20/1593) and 96.5% (1537/1593) respectively. The mean viral load for HBs Ag reactive individuals was 520±809 IU/ml, while those in the reactivation immune pathological pattern had the highest viral load (1495.0±2755) compared to the immune clearance and the inactive carrier groups (451±250 and 437±399.0 respectively) (p=0.0001).
|
Variables |
HBs Ag reactive individuals |
Comparators [apparently healthy] |
p-value |
|
Mean age/years±SD |
35.4±11.6 |
32.00±9.9 |
0.4 |
|
ALT (IU/ml) |
20.6±36.1 |
9.6±5.9 |
0.008* |
|
AST (IU/ml) |
31.2±94.0 |
12.3±6.8 |
0.001* |
|
Total Proteins (grams/dL) |
07.0±0.8 |
07.8±6.8 |
0.06 |
|
Albumin (grams/dL) |
03.8 ±0.7 |
03.9±0.8 |
0.9 |
|
Total Bilirubin (mg/dL) |
0.70±1.8 |
0.459±0.2 |
0.1 |
|
Direct Bilirubin (mg/dL) |
0.3±1.3 |
0.14±0.04 |
0.3 |
|
HBe Ag+ |
4.9% (78/1593 |
__ |
___ |
|
HBe Ab+ |
67% (1070/1593) |
__ |
___ |
|
Total HBc Ab |
77.7% (1238/1593) |
__ |
___ |
Table 1 Mean age, aminotransferases levels, total proteins/albumin and bilirubin in HBs Ag positive and HBsAg Negative apparently healthy individuals
[Comparators]
Continuous variables are expressed as mean±SD *statistically significant
|
Variables |
HBe Ag reactive |
HBe Ag non-reactive |
p-value |
|
Mean age/years±SD |
35.4±11.6 |
32.00±9.9 |
0.4 |
|
ALT (IU/ml) |
127.2±205.2 |
15.2±9.3 |
0.001* |
|
AST (IU/ml) |
336.7±543.3 |
19.9±10.6 |
0.001* |
|
Total Proteins (grams/dL) |
07.3±0.8 |
07.2±3.7 |
0.9 |
|
Albumin (grams/dL) |
03.7±0.8 |
03.9±0.7 |
0.5 |
|
Total Bilirubin (mg/dL) |
05.6±10.5 |
0.6±0.3 |
0.001* |
|
Direct Bilirubin (mg/dL) |
04.0±7.9 |
0.093±0.005 |
0.001* |
Table 2 Mean ages, aminotransferases levels, total proteins/albumin and Bilirubin levels in HBe Ag reactive
Continuous variables are expressed as mean±SD, *statistically significant
Hepatitis B virus infection is among the most neglected diseases with a considerable mortality risk worldwide, the African and Western Pacific regions accounted for the majority of cases. Despite the availability of an efficacious vaccine and a number of anti-viral drugs, the elimination of HBV infection is far from achievable. This is due to persistent cases of CHBV cases that continuously feed the pool of new HBV cases. The dilemma to treat patients with CHBV is ever brewing and patients have to be advised wisely to save money, prevent drug toxicity and emergence of drug-resistance. The choice is between: no treatment with regular follow ups and treatment with a limited period of IFNα or life-long use of oral nucleo(s) tides analogues with mounting cost/toxic effects/induction of drug resistance.
Understanding the genotypes of HBV and the immune pathological patterns of CHBV are very important to modify management strategies, a right step towards treatment personalization. Triaging patients to treatment or no treatment has to be based on genotyping HBV and delineation of immune pathological patterns CHBV. It is well documented that HBe Ag negative chronic carriers have reduced sustained responses to nucleoside/nucleotide analogues. It has also been reported that IFNα is less effective against HBV genotypes D and C and that lamivudine resistance is higher among patients harboring HBV genotype A. Nucleosides/nucleotides analogues singly or in combination could lead to measurable virological and biochemical response, but does not significantly suppress the development of hepatocellular carcinoma.3,19–27
The commonest age group affected in our study cohort is younger than that reported from the Far East, where the patients were in their late forties. The predominance of males, may point to the fact that males are probably more affected than females, concordant with results for other regions. On the other hand, this probably indicates female’s decreased treatment seeking attitudes in developing communities. The majority of HBs Ag reactive Sudanese individuals were HBc Ab reactive, less than that reported from other regions, which indicates that HBV immunity is mostly acquired through viral exposure in the community.23,28 A small per cent age of the study individuals were Hbe Ag reactive with significantly higher aminotransferases/total and direct bilirubins levels compared to Hbe Ag non-reactive individuals. This probably indicates increased disease activity and viral replication. A small per cent age of the study cohort were, HBs Ag+/Hbe Ag+/HBc IgM reactive probably indicating acute infection within the recent 6-8 months. These individuals will either go to develop anti HBs and anti-HBc IgG with elimination of the virus and be cured. Alternatively, anti-Hbc IgM will disappear with appearance of anti-HBc IgG antibodies and persistence of the infection (chronic inactive carrier). Reports were very variable about the clinical significance of IgM/Ig G anti-HBc antibodies as markers for virus replication.29–32 HBe Ag was seen in a small per cent ages of HBs Ag+ individuals, while the majority of our patients were HBe Ab reactive. Concurrent Hbs Ag/Hbe Ag and their corresponding antibodies is well documented. CHBV with low levels of HBs Ag have low levels of viral DNA i.e. low replication as was seen in a small per cent age of the study cohort.33 Cheng and colleagues34 reported that the majority of their patients were Hbs Ag/HBe Ag/Hbc Ag reactive, a finding that is discordant with our findings.34 Hbe Ag/HBe Ab non-reactivity was seen in the majority of our cohort, this probably indicates disease inactivity or immune exhaustion that has been well-documented in CHBV. Furthermore, Hbe Ag/HBe Ab non-reactivity could mean mutations in the pre-core or core regions of the viral genome. A small numbers of the study cohort showed co-existence of HBs Ag/Hbs Ab reactive probably on a transitional state to clear the virus or probably suggesting a selection of immune escape mutants during the disease period, a finding previously reported.32,34–37 Individuals with immune tolerance CHBV could not be identified within the study cohort, in agreement with recent reports that challenged the early concepts of existence of this immune pathologic phase. Recent evidence showed that subtle liver damage in the presence of normal aminotransferases levels exits in CHBV individuals.10,32,34–37
In conclusion, inactive carrier state is the predominant immune-pathological phase among Chronic HBV Sudanese individuals. Regular follow ups and no anti-viral drug treatment should be advocated as the management of choice to reduce cost, drug-associated toxicities and emergence of resistant strains.
None.
The authors declare no conflicts of interest.
©2020 :, et al. This is an open access article distributed under the terms of the, which permits unrestricted use, distribution, and build upon your work non-commercially.